| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.121426 |
| Chromosome: | chromosome 3 |
| Location: | 7964406 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g202000 | KIN4B,KIN4-2 | Kinesin motor protein; (1 of 4) K10395 - kinesin family member 4/21/27 (KIF4_21_27) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATACGCCCGACCACGCCCGTGCTAATGGT |
| Internal bar code: | CCGACCCGGCGCGAGTGGTGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 801 |
| LEAP-Seq percent confirming: | 99.9229 |
| LEAP-Seq n confirming: | 3886 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACAAGTCGTGAAACGTCCC |
| Suggested primer 2: | TGACAGCTGGTGTAGCGTTC |