| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.121459 |
| Chromosome: | chromosome 8 |
| Location: | 1339951 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g363950 | (1 of 2) PF07819 - PGAP1-like protein (PGAP1); Putative Glucan Water Dikinase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTATTGAATTGCGTTCTAATTGCGGGTTTT |
| Internal bar code: | GCCCCACTCGGTGTAGTTGAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 418 |
| LEAP-Seq percent confirming: | 89.1758 |
| LEAP-Seq n confirming: | 898 |
| LEAP-Seq n nonconfirming: | 109 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAGGTTGCCTCTGGAACTT |
| Suggested primer 2: | AGACATGCACACTTTGCAGC |