| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.121578 |
| Chromosome: | chromosome 1 |
| Location: | 2589627 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g015100 | CSB5 | (1 of 70) PF07282 - Putative transposase DNA-binding domain (OrfB_Zn_ribbon); {"Probable transposon-derived protein of Chlamydomonas-Specific family B | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATGAACGCAAGCAAATGAGCGGTCGATGG |
| Internal bar code: | ACATCCAGGTGGGGGGACTCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 542 |
| LEAP-Seq percent confirming: | 99.5381 |
| LEAP-Seq n confirming: | 1293 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGACCTCAAACCAGACACC |
| Suggested primer 2: | AGGAGGAGGCGAAGGAGTAG |