| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.121820 |
| Chromosome: | chromosome 6 |
| Location: | 5359379 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g283550 | CRC2,POC6 | Proteome of centriole protein 6; (1 of 1) K16466 - centrin-3 (CETN3, CDC31) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCGAAGCAGAAAGGGTCTGGCACGGTAT |
| Internal bar code: | TGGGTTGCCGGCAGCAATCGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 894 |
| LEAP-Seq percent confirming: | 99.6773 |
| LEAP-Seq n confirming: | 2780 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAGATCATCCCTTCAACCC |
| Suggested primer 2: | GCTAGCTTCTCCCTGGAGGT |