| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.121824 |
| Chromosome: | chromosome 4 |
| Location: | 3543066 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g228300 | STK | (1 of 19) K08850 - aurora kinase, other [EC:2.7.11.1] (AURKX); Serine/threonine protein kinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGAAGTAGGTCCCACTCGCTGCCGCCTG |
| Internal bar code: | GTGGATTGGGTTCGAGCGGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 972 |
| LEAP-Seq percent confirming: | 93.3713 |
| LEAP-Seq n confirming: | 2789 |
| LEAP-Seq n nonconfirming: | 198 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGACTACATGGTGAGCAGC |
| Suggested primer 2: | ATGAGCACAAGCATCGTGAG |