| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.122054 |
| Chromosome: | chromosome 17 |
| Location: | 1070563 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g703750 | (1 of 1) PF14222 - Cell morphogenesis N-terminal (MOR2-PAG1_N) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGACTGCTGCCCAACGTGTCCACCACCTT |
| Internal bar code: | ACACCGTCGCCACGGTGTAGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1 |
| LEAP-Seq percent confirming: | 64.1814 |
| LEAP-Seq n confirming: | 835 |
| LEAP-Seq n nonconfirming: | 466 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGGCAAAACACAGTTCGGT |
| Suggested primer 2: | GTCACTGACCTGCTTCTGGG |