Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.122084 |
Chromosome: | chromosome 10 |
Location: | 4250810 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g450350 | Hspb11,FAP232,IFT25 | Intraflagellar Transport Protein 25; (1 of 1) K19369 - heat shock protein beta-11 (HSPB11) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTTCCGCATCCCGCACTCGACAACACTAT |
Internal bar code: | AGCGTCGCCGTCGCGCTTAACT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 297 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 4 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTCCTTTCCGCTCTGGTCTA |
Suggested primer 2: | GGTGCATTGTGACGTGATTC |