Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.122117 |
Chromosome: | chromosome 7 |
Location: | 1332790 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g322300 | XPD4,RAD3D | RAD3/XP-D family DNA-binding helicase; (1 of 1) K11273 - chromosome transmission fidelity protein 1 [EC:3.6.4.13] (DDX11, CHL1, CTF1) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTAGGCGAATGACGGCGCGAACACCACCA |
Internal bar code: | GCTGGATCTGTTGCAATACCCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 359 |
LEAP-Seq percent confirming: | 43.6464 |
LEAP-Seq n confirming: | 4977 |
LEAP-Seq n nonconfirming: | 6426 |
LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTTTCGTTTTCTCAGCACA |
Suggested primer 2: | GTTTACGAACGGCGATGATT |