Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.122146 |
Chromosome: | chromosome 11 |
Location: | 3728434 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g482900 | RAB20,RAB18C,RABC3 | Small Rab-related GTPase; (1 of 3) K07910 - Ras-related protein Rab-18 (RAB18) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTGGCGCCAGTCCCACCGTTCCCGCATAC |
Internal bar code: | TCTGTTCATTTAAGCTCTGACA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 189 |
LEAP-Seq percent confirming: | 65.9074 |
LEAP-Seq n confirming: | 897 |
LEAP-Seq n nonconfirming: | 464 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGGGCATCATCTTTGGTGAG |
Suggested primer 2: | ATGTGTACGTTAGCCCGAGG |