| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.122163 |
| Chromosome: | chromosome 2 |
| Location: | 807966 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g078939 | CRY-DASH1,DCRY1 | (1 of 3) K01669 - deoxyribodipyrimidine photo-lyase [EC:4.1.99.3] (phrB); DASH-type Cryptochrome 1 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGTACAAGTGAGGGGCTGGCAGGGGGTCC |
| Internal bar code: | CCTTAAAGAGGTTGGTATGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1010 |
| LEAP-Seq percent confirming: | 98.4615 |
| LEAP-Seq n confirming: | 192 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCCTCACTGTCCCCACACT |
| Suggested primer 2: | CTACGACCCCACTGGTGAGT |