| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.122377 |
| Chromosome: | chromosome 16 |
| Location: | 5015464 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g684750 | (1 of 1) 1.1.1.184//1.1.1.307 - Carbonyl reductase (NADPH) / Xenobiotic ketone reductase // D-xylose reductase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTATTGTGTGTTCGGGCAAATGGACATGGC |
| Internal bar code: | TACCCTCTTGCTCCGCCGGCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 654 |
| LEAP-Seq percent confirming: | 99.9007 |
| LEAP-Seq n confirming: | 3019 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGATTTCGGCAAGTTTGTG |
| Suggested primer 2: | GAAGTTCGTTACGCCCACAT |