| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.122382 |
| Chromosome: | chromosome 12 |
| Location: | 4868479 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g525100 | SMC6B | (1 of 2) PTHR19306//PTHR19306:SF6 - STRUCTURAL MAINTENANCE OF CHROMOSOMES 5,6 SMC5, SMC6 // PROTEIN C23H4.6, ISOFORM A-RELATED; Structural Maintenance of Chromosomes protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAAGATGTCGCGAAATTGTCGGCAGGTACA |
| Internal bar code: | GTGCTGGCCAATCCCTGCGTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 577 |
| LEAP-Seq percent confirming: | 99.0521 |
| LEAP-Seq n confirming: | 209 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGATGCTGATGCTGATGCT |
| Suggested primer 2: | TGAAGTTGCAGGAGACATGC |