| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.122420 |
| Chromosome: | chromosome 10 |
| Location: | 5216218 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g456950 | CEP10 | Cysteine endopeptidase; (1 of 1) IPR000668//IPR008979//IPR013128//IPR018392//IPR029062 - Peptidase C1A, papain C-terminal // Galactose-binding domain-like // Peptidase C1A // LysM domain // Class I glutamine amidotransferase-like | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACGTGGTGTGGCTCACAATCAAAATGTTC |
| Internal bar code: | GACGGTCGACGCCATACACTACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 963 |
| LEAP-Seq percent confirming: | 97.9746 |
| LEAP-Seq n confirming: | 2467 |
| LEAP-Seq n nonconfirming: | 51 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGCCATGATGAGTTGATG |
| Suggested primer 2: | GCAAACATCAACCACCACAG |