| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.122477 |
| Chromosome: | chromosome 1 |
| Location: | 2875937 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g017450 | POLA2,DIV46 | (1 of 1) K02321 - DNA polymerase alpha subunit B (POLA2); DNA polymerase alpha, catalytic subunit | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGATTACACCCTGCGCCGCGAGATGCGGG |
| Internal bar code: | CATAGATTGAGTATCGCCGGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 453 |
| LEAP-Seq percent confirming: | 97.6978 |
| LEAP-Seq n confirming: | 1655 |
| LEAP-Seq n nonconfirming: | 39 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGAGCGATGACCTGTCGTA |
| Suggested primer 2: | CATCTACCGTTGTTCCCCAC |