| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.122508 |
| Chromosome: | chromosome 2 |
| Location: | 2024725 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g088600 | ACL2,ACLB1 | (1 of 2) 2.3.3.8 - ATP citrate synthase / Citric cleavage enzyme; ATP citrate lyase, subunit B | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCAGCGGCAGGGCTGCAGCACAGTAGCAC |
| Internal bar code: | TAGACTGCCCATATGCCGATGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 800 |
| LEAP-Seq percent confirming: | 99.7009 |
| LEAP-Seq n confirming: | 1000 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGAAATGTCGCTGCCTGTA |
| Suggested primer 2: | GTTTGCGACCTAGCGACTTC |