| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.122589 |
| Chromosome: | chromosome 2 |
| Location: | 2352907 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g090950 | (1 of 78) IPR002110//IPR020683 - Ankyrin repeat // Ankyrin repeat-containing domain | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCTTCTGCAAGGGAGAGACATCATATTGT |
| Internal bar code: | GGCGATAAGTTTGCACACTTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 816 |
| LEAP-Seq percent confirming: | 99.4519 |
| LEAP-Seq n confirming: | 7258 |
| LEAP-Seq n nonconfirming: | 40 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTGTTCGTGTGGAAGTTCG |
| Suggested primer 2: | CCGAGTGCAATTACAACCCT |