| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.122619 |
| Chromosome: | chromosome 3 |
| Location: | 4042883 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g172350 | (1 of 1) PF14736 - Protein N-terminal asparagine amidohydrolase (N_Asn_amidohyd) | 3'UTR | |
| Cre03.g172376 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTCCAGCATTATATGTCATTGTAGCGCTA |
| Internal bar code: | TAAAGCAACGCTCAACCATGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 593 |
| LEAP-Seq percent confirming: | 98.1633 |
| LEAP-Seq n confirming: | 481 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTCACTCCTTGCCTCACTC |
| Suggested primer 2: | TCCCTCCTGTTCCCTTCTTT |