Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.122624 |
Chromosome: | chromosome 12 |
Location: | 3528392 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g513254 | (1 of 2) K15340 - DNA cross-link repair 1A protein (DCLRE1A, SNM1A, PSO2) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTCCTTCTACTGGGAAGGATATCGCACAA |
Internal bar code: | GAATTTGAAGTGGCGTGAAACA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 947 |
LEAP-Seq percent confirming: | 99.8804 |
LEAP-Seq n confirming: | 1670 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACTCCCAGGATGGACACTT |
Suggested primer 2: | CGACACACAACATCCTCCAC |