Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.122810 |
Chromosome: | chromosome 8 |
Location: | 1534089 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g364862 | (1 of 1) PF07714//PF13185 - Protein tyrosine kinase (Pkinase_Tyr) // GAF domain (GAF_2) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGACGGGGCGGGACGCGTCAGGGAGGGTG |
Internal bar code: | CCGTCAAACGGCGTAACTTAGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 815 |
LEAP-Seq percent confirming: | 98.1723 |
LEAP-Seq n confirming: | 2256 |
LEAP-Seq n nonconfirming: | 42 |
LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTTGATGAGGAGGAGTTCGG |
Suggested primer 2: | CCTCTGCTGAAACAGCATCA |