| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.122816 |
| Chromosome: | chromosome 17 |
| Location: | 3189663 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g722000 | MFT30,SOC1 | Major facilitator superfamily transporter; (1 of 1) K08214 - MFS transporter, OCT family, solute carrier family 22 (organic cation transporter), member 18 (SLC22A18) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGGGTCCGTGAAGGTGCATGCGGTCACAT |
| Internal bar code: | GGAAATACTAGGCGGCTCTCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 27 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 69 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGAATAGCTGGCTTGGCGT |
| Suggested primer 2: | CCATGTACTGCCTCCCTGTT |