| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.122850 |
| Chromosome: | chromosome 4 |
| Location: | 1478378 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g213950 | SRR23 | Scavenger receptor cysteine rich (SRCR) protein; (1 of 20) IPR001190//IPR017448 - SRCR domain // SRCR-like domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGCATGCACGGCCGGGGCCCAGACTAAC |
| Internal bar code: | CGATCCCGGATTTTGTGGGTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 398 |
| LEAP-Seq percent confirming: | 94.2248 |
| LEAP-Seq n confirming: | 5792 |
| LEAP-Seq n nonconfirming: | 355 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCACGTGCTAGCTGTTGTGT |
| Suggested primer 2: | GCACACACATTCACACACCA |