| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.122872 |
| Chromosome: | chromosome 10 |
| Location: | 1470171 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g428678 | GID1,MNMG1,MNMG | (1 of 1) K03495 - tRNA uridine 5-carboxymethylaminomethyl modification enzyme (gidA, mnmG, MTO1); tRNA uridine 5-carboxymethylaminomethyl modification enzyme | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACATGCAATCCCGACTGTCCCAAGCACTCC |
| Internal bar code: | GCATCAAGAACCTGAGGCGGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 541 |
| LEAP-Seq percent confirming: | 96.3631 |
| LEAP-Seq n confirming: | 3206 |
| LEAP-Seq n nonconfirming: | 121 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCATCAATGTAACAACCGCC |
| Suggested primer 2: | GCGGGACAGAGTTGAGAGTC |