Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.122963 |
Chromosome: | chromosome 10 |
Location: | 4792306 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g453807 | CTPB1 | (1 of 2) PTHR32060:SF5 - PEPTIDASE S41 FAMILY PROTEIN; C-terminal peptidase B | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTCGGATTTGCCACACTTTCACTCGCGGC |
Internal bar code: | TAAAAGTTCGTCCGGTAAAATG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 113 |
LEAP-Seq percent confirming: | 62.6506 |
LEAP-Seq n confirming: | 104 |
LEAP-Seq n nonconfirming: | 62 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTAACTGACCTCTGCCGCTC |
Suggested primer 2: | GAGGGGTGTGTGTGTGTGAG |