| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.122974 |
| Chromosome: | chromosome 16 |
| Location: | 7701232 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g690879 | FAP173 | (1 of 1) PTHR10264//PTHR10264:SF84 - BAND 7 PROTEIN-RELATED // HYPERSENSITIVE-INDUCED RESPONSE PROTEIN 2; Flagellar Associated Protein 173 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATACTGTGGAGGCGCGGTTGTGCGCACCCA |
| Internal bar code: | ACCGGCACAAGTCGCAAACGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 758 |
| LEAP-Seq percent confirming: | 99.6307 |
| LEAP-Seq n confirming: | 2698 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAGACAGGAGAAGTACCGC |
| Suggested primer 2: | ATTGAAATGCAGCCCTTGTC |