| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.122984 |
| Chromosome: | chromosome 16 |
| Location: | 6363528 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g674000 | WDR2,LWD1 | (1 of 1) K11805 - WD repeat-containing protein 68 (WDR68, HAN11); WD-4 repeat family protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCGTGAATTGTTCCTGCCTGTCTTGCCAA |
| Internal bar code: | ACGGCCTGGTGCCACGGGACAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 336 |
| LEAP-Seq percent confirming: | 7.75132 |
| LEAP-Seq n confirming: | 869 |
| LEAP-Seq n nonconfirming: | 10342 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTGCCATCGCTCTGTCTTT |
| Suggested primer 2: | GCGAGGTGGTTCACCTAAAA |