| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.123081 |
| Chromosome: | chromosome 10 |
| Location: | 3672864 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g445900 | (1 of 1) PF00226//PF14901 - DnaJ domain (DnaJ) // Cleavage inducing molecular chaperone (Jiv90) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGTTCACCAAGCCCGAACCGGAGCGCTT |
| Internal bar code: | GGAAGGTGCCCACGAGCCACGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 275 |
| LEAP-Seq percent confirming: | 57.9027 |
| LEAP-Seq n confirming: | 381 |
| LEAP-Seq n nonconfirming: | 277 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAGCAATGGGTTTCATTTT |
| Suggested primer 2: | TAGAACAACCCCTGTACCGC |