| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.123148 |
| Chromosome: | chromosome 1 |
| Location: | 3313268 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g020918 | PREP1 | (1 of 1) PTHR11851:SF68 - PRESEQUENCE PROTEASE 1, CHLOROPLASTIC/MITOCHONDRIAL-RELATED; Presequence protease 1 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCAACTGCCACAACCACCGCGGTCACAAC |
| Internal bar code: | TAGAACGCGGCCCTTCCATCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 329 |
| LEAP-Seq percent confirming: | 99.4318 |
| LEAP-Seq n confirming: | 175 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGAGCGCGACATCGTTAAGT |
| Suggested primer 2: | GGACTTCAAGTGGGTGGAGA |