| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.123209 |
| Chromosome: | chromosome 4 |
| Location: | 250327 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g217550 | EIF3C | (1 of 1) K03252 - translation initiation factor 3 subunit C (EIF3C); Eukaryotic translation initiation factor 3, subunit C | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATGCCCAGAAAACGGTGGAGGGGGCAGCA |
| Internal bar code: | GGTCTTCACGAAGGTGCAGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 204 |
| LEAP-Seq percent confirming: | 78.4788 |
| LEAP-Seq n confirming: | 3147 |
| LEAP-Seq n nonconfirming: | 863 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCAGCTTGCTTTGTTGCAG |
| Suggested primer 2: | AACCGGGCACAGTGACTATC |