| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.123240 |
| Chromosome: | chromosome 8 |
| Location: | 4393526 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g381950 | YAK1,TAR1 | (1 of 1) K18670 - dual specificity protein kinase YAK1 [EC:2.7.12.1] (YAK1); DYRK-type protein kinase/Yet-another-kinase 1 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTGGCGCCGGAACAGGAAGAAGTCCACCA |
| Internal bar code: | GGGGCCTGTTATAGGCACTGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 325 |
| LEAP-Seq percent confirming: | 86.9724 |
| LEAP-Seq n confirming: | 5728 |
| LEAP-Seq n nonconfirming: | 858 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCACACACAACACACAGCA |
| Suggested primer 2: | AAGCATGTGTGGACTGTGGA |