| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.123265 |
| Chromosome: | chromosome 12 |
| Location: | 5200652 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g527800 | DNAL4,LC10,ODA-LC10,DLC10,DLL3,MOT24 | Outer Arm Dynein Light Chain; (1 of 1) K10412 - dynein light chain 4, axonemal (DNAL4) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACTCCGTCGCACGGACGCTCTGACGCCTT |
| Internal bar code: | AAACGGCAGGTAGGGAATGGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 571 |
| LEAP-Seq percent confirming: | 99.3983 |
| LEAP-Seq n confirming: | 826 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGCACAGTATGCCCGTACC |
| Suggested primer 2: | TGCACGTTGAGATGAAGGAG |