| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.123278 |
| Chromosome: | chromosome 14 |
| Location: | 1255204 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g616450 | CYG46 | (1 of 2) PF00211//PF03924 - Adenylate and Guanylate cyclase catalytic domain (Guanylate_cyc) // CHASE domain (CHASE); Adenylate/guanylate cyclase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCACAGGCGGGCATGTACCCTCATTTTAA |
| Internal bar code: | GGTAGAGCTTCATGATACGCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 514 |
| LEAP-Seq percent confirming: | 99.8702 |
| LEAP-Seq n confirming: | 2308 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACGAAAAGGGATTCGTTG |
| Suggested primer 2: | GGCTTGGCTAGGACTCACTG |