| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.123284 |
| Chromosome: | chromosome 16 |
| Location: | 2618161 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g661750 | (1 of 2) PF08332 - Calcium/calmodulin dependent protein kinase II association domain (CaMKII_AD) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAGCCGCAAACGCTGCACACACCCATCAC |
| Internal bar code: | AAGATCCATAACGTGCAGCCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 788 |
| LEAP-Seq percent confirming: | 99.8733 |
| LEAP-Seq n confirming: | 1576 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTTGTGTTTGAGCGCTGT |
| Suggested primer 2: | GTAAACACCACGCCACAATG |