Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.123373 |
Chromosome: | chromosome 14 |
Location: | 234163 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g609250 | (1 of 1) PF13839 - GDSL/SGNH-like Acyl-Esterase family found in Pmr5 and Cas1p (PC-Esterase) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACTGCCTCGTGCCCACGCCCTCCGCCGCC |
Internal bar code: | GGGCGCGCAATACGACATCCTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 222 |
LEAP-Seq percent confirming: | 91.7098 |
LEAP-Seq n confirming: | 354 |
LEAP-Seq n nonconfirming: | 32 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCGAGTGAAGAAGACCTTGG |
Suggested primer 2: | TTTGCGGTCTCAGTCATCTG |