Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.123442 |
Chromosome: | chromosome 10 |
Location: | 3217142 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g442700 | RVB2,RUVBL2,Reptin | Nucleoside-triphosphatase, RuvB-like protein; (1 of 1) K11338 - RuvB-like protein 2 [EC:3.6.4.12] (RUVBL2, RVB2, INO80J) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACACCGCCATGGGCTGAGTGCAACCAGGG |
Internal bar code: | CGCGACGACTCACACTACATGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 662 |
LEAP-Seq percent confirming: | 99.8849 |
LEAP-Seq n confirming: | 868 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCAGATCACCGGTGTAGGTT |
Suggested primer 2: | CAGCTCCCGTCTTAAGTTGC |