| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.123496 |
| Chromosome: | chromosome 4 |
| Location: | 634246 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g217945 | FAD5D | Putative Linoleate desaturase; (1 of 2) K00507 - stearoyl-CoA desaturase (delta-9 desaturase) (SCD, desC) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCGGCTACGGAATCTTTCAGGCTTTAAT |
| Internal bar code: | TGAGACCACGCCTCGGATGAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 812 |
| LEAP-Seq percent confirming: | 99.8119 |
| LEAP-Seq n confirming: | 1592 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAATACATACGCACCATGC |
| Suggested primer 2: | AGATACCGGTACTTGTGGCG |