| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.123642 |
| Chromosome: | chromosome 2 |
| Location: | 6382505 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g115450 | CYG47 | (1 of 5) IPR000104//IPR001054//IPR029787 - Antifreeze protein, type I // Adenylyl cyclase class-3/4/guanylyl cyclase // Nucleotide cyclase; Adenylate/guanylate cyclase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTAGCAACCGCACTTCTGATTGACCTACTG |
| Internal bar code: | CCCGGGCACGTAAGGCTTAGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 838 |
| LEAP-Seq percent confirming: | 99.8089 |
| LEAP-Seq n confirming: | 5224 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGGACGTGAATGGGTCTGT |
| Suggested primer 2: | CACATGCAATCCAGGATACG |