| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.123684 |
| Chromosome: | chromosome 16 |
| Location: | 1027227 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g649200 | (1 of 17) PF04755 - PAP_fibrillin (PAP_fibrillin) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAAGAGGCTGTTCAATCCTTGTAAGCTGC |
| Internal bar code: | GGTTAGATATCTTTAGTGTGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 323 |
| LEAP-Seq percent confirming: | 99.8012 |
| LEAP-Seq n confirming: | 6023 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGAGGAGAGCAAGCTGACG |
| Suggested primer 2: | CTCCTTCGACCTGCTAGTGG |