Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.123756 |
Chromosome: | chromosome 12 |
Location: | 6971744 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g560150 | RAB1,FAP353,RABD1 | (1 of 1) K07874 - Ras-related protein Rab-1A (RAB1A); Rab-like GTP-Binding Flagellar Associated Protein 353 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTAAATTAAGAGTTCTCGTCGGGTTGCCC |
Internal bar code: | GCGGAATGGCCCTTCACTAACC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 843 |
LEAP-Seq percent confirming: | 99.8958 |
LEAP-Seq n confirming: | 3835 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTGTCTGCACAGGCTTTTC |
Suggested primer 2: | CATCAACAGCAAGTCGTCGT |