| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.123789 |
| Chromosome: | chromosome 2 |
| Location: | 4673921 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g101500 | MRS1 | Mg2+ transporter protein; (1 of 3) K16075 - magnesium transporter (MRS2, MFM1) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAACATGAGCGGCGGCGCGCCCGGCGGCC |
| Internal bar code: | TCTTGCCACCGCTACGAAGACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 694 |
| LEAP-Seq percent confirming: | 66.9337 |
| LEAP-Seq n confirming: | 4595 |
| LEAP-Seq n nonconfirming: | 2270 |
| LEAP-Seq n unique pos: | 45 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACCTGAGAAAGCATGGAGC |
| Suggested primer 2: | AGTCCACCGGAACAAACAAG |