| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.123800 |
| Chromosome: | chromosome 5 |
| Location: | 1661780 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g243000 | (1 of 1) K14491 - two-component response regulator ARR-B family (ARR-B) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTGGCTTGGCTTGGCTCGGGTTGGGTTGG |
| Internal bar code: | TGCATGGTAATCCATGGCTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 697 |
| LEAP-Seq percent confirming: | 99.5195 |
| LEAP-Seq n confirming: | 2071 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGACTCATGCAACAACCCA |
| Suggested primer 2: | ACGTCATGTACGGCACACC |