| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.123956 |
| Chromosome: | chromosome 17 |
| Location: | 1410838 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g706450 | LIC3 | (1 of 1) IPR000104//IPR006029//IPR006201//IPR006202 - Antifreeze protein, type I // Neurotransmitter-gated ion-channel transmembrane domain // Neurotransmitter-gated ion-channel // Neurotransmitter-gated ion-channel ligand-binding domain; Ligand-gated ion channel | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGCCTGCTTAGCAGCGGCTGCTGCGATAG |
| Internal bar code: | TCTTGCTGTGGAAGTGGGGGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 252 |
| LEAP-Seq percent confirming: | 66.3155 |
| LEAP-Seq n confirming: | 6168 |
| LEAP-Seq n nonconfirming: | 3133 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGGACGGATTTCTTCTTTG |
| Suggested primer 2: | AAAGGGGTAAGCACGGAAGT |