Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.123959 |
Chromosome: | chromosome 2 |
Location: | 4265726 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g099000 | SYP71 | Qc-SNARE protein, SYP7-family; (1 of 2) K08506 - syntaxin of plants SYP7 (SYP7) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGATGCTTGTAGTAGCAACAAGCAAGCTT |
Internal bar code: | TCAACAAACATAAGCCACCGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 676 |
LEAP-Seq percent confirming: | 95.1735 |
LEAP-Seq n confirming: | 631 |
LEAP-Seq n nonconfirming: | 32 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TACCAGGGCTCTGTTCTGCT |
Suggested primer 2: | AGCCTGTCGGTAATGGTCAC |