| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.124005 |
| Chromosome: | chromosome 11 |
| Location: | 334074 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467568 | (1 of 1) K06276 - 3-phosphoinositide dependent protein kinase-1 (PDPK1) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGAAGGTCGGCAGGGGGTGGGATTGTAT |
| Internal bar code: | TTGTCACCGGGAGGGCGCCGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 340 |
| LEAP-Seq percent confirming: | 99.3737 |
| LEAP-Seq n confirming: | 4760 |
| LEAP-Seq n nonconfirming: | 30 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGACCACCCTACTCCTCAC |
| Suggested primer 2: | TTCCCATTTGAAGTTCTGCC |