Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.124019 |
Chromosome: | chromosome 3 |
Location: | 2052051 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g156400 | SMM8 | S-adenosyl-L-methionine-dependent methyltransferase; (1 of 1) 2.1.1.145 - Trans-aconitate 3-methyltransferase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGCCGGCGCTCCTCTTTCCCAGCGCGCT |
Internal bar code: | ACCATGCGGTACAGTTTATGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 282 |
LEAP-Seq percent confirming: | 99.908 |
LEAP-Seq n confirming: | 1086 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACACAAACTACAGACCGCCC |
Suggested primer 2: | AGAGTTATCAGGCCAGGGGT |