| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.124026 |
| Chromosome: | scaffold 24 |
| Location: | 64559 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre24.g755597 | Chlorophyll a /Pheophorbide a oxygenase-related protein; (1 of 2) 1.14.13.122 - Chlorophyllide-a oxygenase / Cholorophyll-b synthase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACCCCACAGCACCACAACCATACACGTCA |
| Internal bar code: | GACAGGGCGGACGTTCTAGTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 170 |
| LEAP-Seq percent confirming: | 99.4475 |
| LEAP-Seq n confirming: | 540 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGTTGAAGCATGCAAATCC |
| Suggested primer 2: | CACTCCTACCCTCCTCCCTC |