| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.124043 |
| Chromosome: | chromosome 7 |
| Location: | 1557303 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g324400 | VPS24 | Subunit of the ESCRT-III complex; (1 of 1) K12193 - charged multivesicular body protein 3 (VPS24, CHMP3) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCTCTTTGCCCTTCGCCCCCGCGGGTTC |
| Internal bar code: | GGCTACTTAATCATTACTGTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 918 |
| LEAP-Seq percent confirming: | 99.6119 |
| LEAP-Seq n confirming: | 770 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAACAGGCAAAGGGGTTAC |
| Suggested primer 2: | GAGAGCAAGGAGCACCAAAC |