Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.124046 |
Chromosome: | chromosome 1 |
Location: | 1984807 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g010750 | RLS10 | RegA/Rls-like protein; (1 of 1) IPR000104//IPR010919 - Antifreeze protein, type I // SAND domain-like | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCACCTCCAACCCTGCCTCCCAGCCCCAT |
Internal bar code: | GGGTCCGGCGGAGTTGATTGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 593 |
LEAP-Seq percent confirming: | 54.2912 |
LEAP-Seq n confirming: | 1689 |
LEAP-Seq n nonconfirming: | 1422 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTAACCCCCGCACTTAAAC |
Suggested primer 2: | GTAGGTAGGGCAGGTAGGGC |