| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.124046 |
| Chromosome: | chromosome 1 |
| Location: | 1984807 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g010750 | RLS10 | RegA/Rls-like protein; (1 of 1) IPR000104//IPR010919 - Antifreeze protein, type I // SAND domain-like | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCACCTCCAACCCTGCCTCCCAGCCCCAT |
| Internal bar code: | GGGTCCGGCGGAGTTGATTGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 593 |
| LEAP-Seq percent confirming: | 54.2912 |
| LEAP-Seq n confirming: | 1689 |
| LEAP-Seq n nonconfirming: | 1422 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTAACCCCCGCACTTAAAC |
| Suggested primer 2: | GTAGGTAGGGCAGGTAGGGC |