Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.124081 |
Chromosome: | chromosome 2 |
Location: | 4846026 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g103200 | (1 of 7) PF00211//PF13416 - Adenylate and Guanylate cyclase catalytic domain (Guanylate_cyc) // Bacterial extracellular solute-binding protein (SBP_bac_8) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTGTAGGGTGGATTCGGGTACCAGCTCAT |
Internal bar code: | TGTCATCCACAGCCCAGGGGAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 746 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 7 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGGTGACTGACATTGGTGG |
Suggested primer 2: | CTGCTGAACTCCTCCTCACC |