Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.124147 |
Chromosome: | chromosome 3 |
Location: | 5634005 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g187200 | LC6,ODA13,DLL2,ODA-LC6 | (1 of 2) K10418 - dynein light chain LC8-type (DYNLL); Outer Arm Dynein Light Chain 6 | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAATTACGTGTCTTCGGGCAGTAAAGGCG |
Internal bar code: | CCCTTACCAGTTGGGTTCGTTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 302 |
LEAP-Seq percent confirming: | 98.8636 |
LEAP-Seq n confirming: | 87 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGGTTGGTCACACTCCTTGG |
Suggested primer 2: | GCCTTCTTCGTGATACGCTC |