Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.124160 |
Chromosome: | chromosome 4 |
Location: | 1804223 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g211900 | ELG35,ELG37 | Exostosin-like glycosyltransferase 37; (1 of 34) 2.4.2.41 - Xylogalacturonan beta-1,3-xylosyltransferase / Xylogalacturonan xylosyltransferase | 3'UTR_intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGGAGCAGGTTGCGCTGCTCCTGGCAGAC |
Internal bar code: | TATCGACCGCGTGAGTCCTTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 728 |
LEAP-Seq percent confirming: | 99.749 |
LEAP-Seq n confirming: | 3577 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCCCCTTTTGCTTTCCTTAC |
Suggested primer 2: | AACTCATTCGAAGCGCCTTA |